| PROMOTER INFORMATION | ||||||||||||||
| 990 | chr14, 100556107-100561167, + | promoter sequence | UCSC |  | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0000788 |
| Located between position 101491354 and 101491414 on chromosome 14 strand + |
| Overlapping with sense strand of MIR380-201 (exon 1). |
| (Ensemble: ENST00000362112) |
| mature miRNAs for MI0000788: |
| hsa-miR-380* (MIMAT0000734): TGGTTGACCATAGAACATGCGC |
| hsa-miR-380 (MIMAT0000735): TATGTAATATGGTCCACATCTT |
| You can find this miRNA in HGNC: MIR380 (accession: 31873) |
| References | ||||||||||||||
| [1]Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M, Nature. 432:226-230(2004)., "A pancreatic islet-specific microRNA regulates insulin secretion" | ||||||||||||||
| [2]Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J, Genome Res. 14:1741-1748(2004)., "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" | ||||||||||||||
| [3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 990 | chr14, 100556107-100561167, + | promoter sequence | UCSC | | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |