| PROMOTER INFORMATION | ||||||||||||||
| 1007 | chr14, 100577010-100582084, + | promoter sequence | UCSC |  | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0000789 |
| Located between position 101512257 and 101512331 on chromosome 14 strand + |
| mature miRNAs for MI0000789: |
| hsa-miR-381 (MIMAT0000736): TATACAAGGGCAAGCTCTCTGT |
| You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-381 (accession: hsa-miR-381) |
| References | ||||||||||||||
| [1]Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method" | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 1007 | chr14, 100577010-100582084, + | promoter sequence | UCSC | | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |