Basic information from miRBase |
hairpin accession number: MI0002464 |
Located between position 101531784 and 101531874 on chromosome 14 strand + |
mature miRNAs for MI0002464: |
hsa-miR-412 (MIMAT0002170): ACTTCACCTGGTCCACTAGCCGT |
You can find this miRNA in HGNC: MIR412 (accession: 32064) |
References | ||||||||||||||
[1]Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H, Nucleic Acids Res. 33:2697-2706(2005)., "Clustering and conservation patterns of human microRNAs" |
PROMOTER INFORMATION | ||||||||||||||
1024 | chr14, 100596537-100601627, + | promoter sequence | UCSC |
This microRNA is imprinted (based on ncRNAimprinted database) |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |
Polymorphism data from Patrocles |