| Basic information from miRBase |
| hairpin accession number: MI0001444 |
| Located between position 64163129 and 64163218 on chromosome 15 strand - |
| mature miRNAs for MI0001444: |
| hsa-miR-422a (MIMAT0001339): ACTGGACTTAGGGTCAGAAGGC |
| You can find this miRNA in HGNC: MIR422A (accession: 31879) |
| References | ||||||||||||||
[1]Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"  | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 56 | chr15, 61950577-61950926, - | promoter sequence | Zhou et al. |  | | |||||||||
| 214 | chr15, 62124885-62126146, - | promoter sequence | Marson et al. | | | |||||||||
| 1042 | chr15, 61950182-61955271, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |