miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001445
Located between position 28444097 and 28444190 on chromosome 17 strand +
Overlapping with sense strand of CCDC55-004 (exon 1).
(Ensemble: OTTHUMT00000256124)
mature miRNAs for MI0001445:
         hsa-miR-423-5p (MIMAT0004748): TGAGGGGCAGAGAGCGAGACTTT
         hsa-miR-423-3p (MIMAT0001340): AGCTCGGTCTGAGGCCCCTCAGT
You can find this miRNA in EMBL: AY882274 (accession: AY882274)

References
[1]Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[4]Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F, BMC Genomics. 9:52(2008)., "New miRNAs cloned from neuroblastoma"
[5]Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V, BMC Genomics. 11 Suppl 1:S6(2010)., "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha"


PROMOTER INFORMATION
PROMOTER ID
LOCALIZATION
SEQUENCE
REFERENCE
SNP
TFBS
226 chr17, 25467859-25468059, + promoter sequence Marson et al.
1084 chr17, 25463223-25468316, + promoter sequence UCSC
1305 chr17, 25462959-25467958, + promoter sequence Ozsolak et al. (MALME)
1403 chr17, 25462959-25467958, + promoter sequence Ozsolak et al. (MCF7)
1512 chr17, 25462959-25467958, + promoter sequence Ozsolak et al. (UACC62)


more data
Expression data from PhenomiR
Polymorphism data from Patrocles