Basic information from miRBase |
hairpin accession number: MI0001446 |
Located between position 133680644 and 133680741 on chromosome X strand - |
Overlapping with sense strand of AC004383.4-004 (exon 1). |
(Ensemble: OTTHUMT00000058372) |
mature miRNAs for MI0001446: |
hsa-miR-424 (MIMAT0001341): CAGCAGCAATTCATGTTTTGAA |
hsa-miR-424* (MIMAT0004749): CAAAACGTGAGGCGCTGCTAT |
You can find this miRNA in HGNC: MIR424 (accession: 31881) |
References | ||||||||||||||
[1]Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" | ||||||||||||||
[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
[3]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" |
PROMOTER INFORMATION | ||||||||||||||
455 | chrX, 133505836-133508763, - | promoter sequence | Marson et al. | |||||||||||
842 | chrX, 133508310-133513407, - | promoter sequence | UCSC | |||||||||||
1357 | chrX, 133510849-133515848, - | promoter sequence | Ozsolak et al. (MALME) | |||||||||||
1456 | chrX, 133510829-133515828, - | promoter sequence | Ozsolak et al. (MCF7) | |||||||||||
1560 | chrX, 133510849-133515848, - | promoter sequence | Ozsolak et al. (UACC62) |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |