| Basic information from miRBase |
| hairpin accession number: MI0001641 |
| Located between position 1104385 and 1104467 on chromosome 1 strand + |
| mature miRNAs for MI0001641: |
| hsa-miR-429 (MIMAT0001536): TAATACTGTCTGGTAAAACCGT |
| You can find this miRNA in HGNC: MIR429 (accession: 13784) |
| References | ||||||||||||||
[1]Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M, Nature. 434:338-345(2005)., "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"  | ||||||||||||||
| [2]Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H, Nucleic Acids Res. 33:2697-2706(2005)., "Clustering and conservation patterns of human microRNAs" | ||||||||||||||
| [3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| [4]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 95 | chr1, 1093868-1094217, + | promoter sequence | Zhou et al. |  | | |||||||||
| 100 | chr1, 1088265-1090140, + | promoter sequence | Marson et al. | | | |||||||||
| 523 | chr1, 1089248-1094330, + | promoter sequence | UCSC | | | |||||||||
| 1238 | chr1, 1078333-1083332, + | promoter sequence | Corcoran et al. | | | |||||||||
| 1388 | chr1, 1083380-1088379, + | promoter sequence | Ozsolak et al. (MCF7) | | | |||||||||
| 1553 | chr1, 1078494-1083493, + | promoter sequence | Ozsolak et al. (UACC62) | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |