| PROMOTER INFORMATION | ||||||||||||||
| 984 | chr14, 100415573-100420666, + | promoter sequence | UCSC |  | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0003133 |
| Located between position 101350820 and 101350913 on chromosome 14 strand + |
| Overlapping with antisense strand of RTL1-001 (exon 1). |
| (Ensemble: OTTHUMT00000395127) |
| mature miRNAs for MI0003133: |
| hsa-miR-432 (MIMAT0002814): TCTTGGAGTAGGTCATTGGGTGG |
| hsa-miR-432* (MIMAT0002815): CTGGATGGCTCCTCCATGTCT |
| You can find this miRNA in EMBL: AY785934 (accession: AY785934) |
| References | ||||||||||||||
| [1]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs" | ||||||||||||||
| [2]Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method" | ||||||||||||||
| [3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 984 | chr14, 100415573-100420666, + | promoter sequence | UCSC | | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |