| PROMOTER INFORMATION | ||||||||||||||
| 982 | chr14, 100412976-100418068, + | promoter sequence | UCSC |  | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Pathway information from dPORE-miRNA |
| Basic information from miRBase |
| hairpin accession number: MI0001723 |
| Located between position 101348223 and 101348315 on chromosome 14 strand + |
| Overlapping with antisense strand of RTL1-001 (exon 1). |
| (Ensemble: OTTHUMT00000395127) |
| mature miRNAs for MI0001723: |
| hsa-miR-433 (MIMAT0001627): ATCATGATGGGCTCCTCGGTGT |
| You can find this miRNA in HGNC: MIR433 (accession: 32026) |
| References | ||||||||||||||
| [1]Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H, Nucleic Acids Res. 33:2697-2706(2005)., "Clustering and conservation patterns of human microRNAs" | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 982 | chr14, 100412976-100418068, + | promoter sequence | UCSC | | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Pathway information from dPORE-miRNA |