Basic information from miRBase |
hairpin accession number: MI0001637 |
Located between position 114058017 and 114058127 on chromosome X strand + |
Overlapping with sense strand of HTR2C-003 (intron 4). |
(Ensemble: OTTHUMT00000057963) |
mature miRNAs for MI0001637: |
hsa-miR-448 (MIMAT0001532): TTGCATATGTAGGATGTCCCAT |
You can find this miRNA in HGNC: MIR448 (accession: 26069) |
References | ||||||||||||||
[1]Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M, Nature. 434:338-345(2005)., "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" |
PROMOTER INFORMATION | ||||||||||||||
448 | chrX, 113724706-113724906, + | promoter sequence | Marson et al. | |||||||||||
827 | chrX, 113959273-113964383, + | promoter sequence | UCSC |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |