| more data |
| Expression data from dbDEMC |
| Basic information from miRBase |
| hairpin accession number: MI0017360 |
| Located between position 27188389 and 27188456 on chromosome 17 strand + |
| Overlapping with antisense strand of MIR451-201 (exon 1). |
| (Ensemble: ENST00000385059) |
| mature miRNAs for MI0017360: |
| hsa-miR-451b (MIMAT0019840): TAGCAAGAGAACCATTACCATT |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |
| more data |
| Expression data from dbDEMC |