| Basic information from miRBase |
| hairpin accession number: MI0014157 |
| Located between position 31203196 and 31203279 on chromosome 3 strand - |
| mature miRNAs for MI0014157: |
| hsa-miR-466 (MIMAT0015002): ATACACATACACGCAACACACAT |
| You can find this miRNA in ENTREZGENE: MIR466 (accession: 100423038) |
| References |
| [1]Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK, PLoS One. 5:e9685(2010)., "Characterization of the Melanoma miRNAome by Deep Sequencing" |
| [2]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |