miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002471
Located between position 101518783 and 101518862 on chromosome 14 strand +
mature miRNAs for MI0002471:
         hsa-miR-487a (MIMAT0002178): AATCATACAGGGACATCCAGTT
You can find this miRNA in HGNC: MIR487A (accession: 32343)

References
[1]Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"
[2]Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method"
[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"


PROMOTER INFORMATION
PROMOTER ID
LOCALIZATION
SEQUENCE
REFERENCE
SNP
TFBS
73 chr14, 100588205-100588534, + promoter sequence Zhou et al.
1013 chr14, 100583536-100588615, + promoter sequence UCSC


This microRNA is imprinted (based on ncRNAimprinted database)



more data
Expression data from dbDEMC
Expression data from PhenomiR