| PROMOTER INFORMATION | ||||||||||||||
| 122 | chr1, 175400547-175400747, - | promoter sequence | Marson et al. |  | | |||||||||
| 554 | chr1, 175265122-175270204, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0003123 |
| Located between position 176998499 and 176998581 on chromosome 1 strand - |
| Overlapping with sense strand of ASTN1-005 (intron 3). |
| (Ensemble: OTTHUMT00000084826) |
| mature miRNAs for MI0003123: |
| hsa-miR-488* (MIMAT0002804): CCCAGATAATGGCACTCTCAA |
| hsa-miR-488 (MIMAT0004763): TTGAAAGGCTATTTCTTGGTC |
| You can find this miRNA in HGNC: MIR488 (accession: 32073) |
| References | ||||||||||||||
| [1]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs" | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 122 | chr1, 175400547-175400747, - | promoter sequence | Marson et al. | | | |||||||||
| 554 | chr1, 175265122-175270204, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |