Basic information from miRBase |
hairpin accession number: MI0003124 |
Located between position 93113248 and 93113331 on chromosome 7 strand - |
Overlapping with sense strand of CALCR-005 (intron 3). |
(Ensemble: OTTHUMT00000341744) |
mature miRNAs for MI0003124: |
hsa-miR-489 (MIMAT0002805): GTGACATCACATATACGGCAGC |
You can find this miRNA in EMBL: AY882328 (accession: AY882328) |
References | ||||||||||||||
[1]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs" | ||||||||||||||
[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" |
PROMOTER INFORMATION | ||||||||||||||
399 | chr7, 93041872-93042072, - | promoter sequence | Marson et al. | |||||||||||
714 | chr7, 92951184-92956267, - | promoter sequence | UCSC |
This microRNA is imprinted (based on ncRNAimprinted database) |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |
Polymorphism data from Patrocles |