| Basic information from miRBase |
| hairpin accession number: MI0003126 |
| Located between position 20716104 and 20716187 on chromosome 9 strand + |
| Overlapping with sense strand of KIAA1797-001 (intron 4). |
| (Ensemble: OTTHUMT00000143442) |
| mature miRNAs for MI0003126: |
| hsa-miR-491-5p (MIMAT0002807): AGTGGGGAACCCTTCCATGAGG |
| hsa-miR-491-3p (MIMAT0004765): CTTATGCAAGATTCCCTTCTAC |
| You can find this miRNA in HGNC: MIR491 (accession: 32076) |
| References | ||||||||||||||
[1]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs"  | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| [3]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 424 | chr9, 20648208-20648408, + | promoter sequence | Marson et al. |  | | |||||||||
| 425 | chr9, 20648460-20648660, + | promoter sequence | Marson et al. | | | |||||||||
| 426 | chr9, 20674113-20674313, + | promoter sequence | Marson et al. | | | |||||||||
| 768 | chr9, 20701104-20706187, + | promoter sequence | UCSC | | | |||||||||
| 1276 | chr9, 20672181-20677180, + | promoter sequence | Corcoran et al. | | | |||||||||
| more data |
| Expression data from PhenomiR |