| PROMOTER INFORMATION | ||||||||||||||
| 1020 | chr14, 100591663-100596764, + | promoter sequence | UCSC |  | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0003136 |
| Located between position 101526910 and 101527011 on chromosome 14 strand + |
| mature miRNAs for MI0003136: |
| hsa-miR-496 (MIMAT0002818): TGAGTATTACATGGCCAATCTC |
| You can find this miRNA in HGNC: MIR496 (accession: 32086) |
| References | ||||||||||||||
| [1]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs" | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 1020 | chr14, 100591663-100596764, + | promoter sequence | UCSC | | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |