| PROMOTER INFORMATION | ||||||||||||||
| 86 | chr19, 58868362-58868711, + | promoter sequence | Zhou et al. |  | | |||||||||
| 1145 | chr19, 58864263-58869386, + | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0003142 |
| Located between position 54177451 and 54177574 on chromosome 19 strand + |
| mature miRNAs for MI0003142: |
| hsa-miR-498 (MIMAT0002824): TTTCAAGCCAGGGGGCGTTTTTC |
| You can find this miRNA in EMBL: AY882319 (accession: AY882319) |
| References | ||||||||||||||
| [1]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs" | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 86 | chr19, 58868362-58868711, + | promoter sequence | Zhou et al. | | | |||||||||
| 1145 | chr19, 58864263-58869386, + | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |