| Basic information from miRBase |
| hairpin accession number: MI0017396 |
| Located between position 33578203 and 33578275 on chromosome 20 strand - |
| Overlapping with antisense strand of MYH7B-001 (intron 20). |
| (Ensemble: OTTHUMT00000078833) |
| mature miRNAs for MI0017396: |
| hsa-miR-499a-5p (MIMAT0019897): ACAGACTTGCTGTGATGTTCA |
| hsa-miR-499a-3p (MIMAT0019898): AACATCACTGCAAGTCTTAACA |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |