miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010644
mature miRNAs for MI0010644:
         lmi-miR-10 (MIMAT0010144): TACCCTGTAGATCCGAATTTGT
         lmi-miR-10* (MIMAT0010145): AAATTCGGTTCTAGAGAGGTTT

References
[1]Wei Y, Chen S, Yang P, Ma Z, Kang L, Genome Biol. 10:R6(2009)., "Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust"