miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010641
mature miRNAs for MI0010641:
         lmi-miR-276* (MIMAT0010138): AGCGAGGTATAGAGTTCCTACG
         lmi-miR-276 (MIMAT0010139): TAGGAACTTCATACCGTGCTCT

References
[1]Wei Y, Chen S, Yang P, Ma Z, Kang L, Genome Biol. 10:R6(2009)., "Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust"