Basic information from miRBase |
hairpin accession number: MI0007570 |
Located between position 105917273 and 105917352 on chromosome 15 strand + |
mature miRNAs for MI0007570: |
mml-let-7a (MIMAT0006151): TGAGGTAGTAGGTTGTATAGTT |
You can find this miRNA in ENTREZGENE: MIRLET7A-1 (accession: 100315501) |
References |
[1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |