miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007571
Located between position 120554305 and 120554376 on chromosome 14 strand -
mature miRNAs for MI0007571:
         mml-let-7a (MIMAT0006151): TGAGGTAGTAGGTTGTATAGTT
You can find this miRNA in ENTREZGENE: MIRLET7A-2 (accession: 100315170)

References
[1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome"