Basic information from miRBase |
hairpin accession number: MI0007571 |
Located between position 120554305 and 120554376 on chromosome 14 strand - |
mature miRNAs for MI0007571: |
mml-let-7a (MIMAT0006151): TGAGGTAGTAGGTTGTATAGTT |
You can find this miRNA in ENTREZGENE: MIRLET7A-2 (accession: 100315170) |
References |
[1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |