| Basic information from miRBase |
| hairpin accession number: MI0007572 |
| Located between position 90121100 and 90121173 on chromosome 10 strand + |
| mature miRNAs for MI0007572: |
| mml-let-7a (MIMAT0006151): TGAGGTAGTAGGTTGTATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7A-3 (accession: 100315442) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |