| Basic information from miRBase |
| hairpin accession number: MI0007573 |
| Located between position 90122017 and 90122099 on chromosome 10 strand + |
| mature miRNAs for MI0007573: |
| mml-let-7b (MIMAT0006152): TGAGGTAGTAGGTTGTGTGGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7B (accession: 100315389) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |