| Basic information from miRBase |
| hairpin accession number: MI0007574 |
| Located between position 30362796 and 30362879 on chromosome 3 strand - |
| mature miRNAs for MI0007574: |
| mml-let-7c (MIMAT0006153): TGAGGTAGTAGGTTGTATGGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7C (accession: 100315171) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |