| Basic information from miRBase |
| hairpin accession number: MI0007575 |
| Located between position 105920139 and 105920225 on chromosome 15 strand + |
| mature miRNAs for MI0007575: |
| mml-let-7d (MIMAT0006154): AGAGGTAGTAGGTTGCATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7D (accession: 100315172) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |