| Basic information from miRBase |
| hairpin accession number: MI0007576 |
| Located between position 57751035 and 57751113 on chromosome 19 strand + |
| mature miRNAs for MI0007576: |
| mml-let-7e (MIMAT0006155): TGAGGTAGGAGGTTGTATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7E (accession: 100315502) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |