| Basic information from miRBase |
| hairpin accession number: MI0007577 |
| Located between position 105917663 and 105917749 on chromosome 15 strand + |
| mature miRNAs for MI0007577: |
| mml-let-7f (MIMAT0006156): TGAGGTAGTAGATTGTATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7F-1 (accession: 100315173) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |