| Basic information from miRBase |
| hairpin accession number: MI0007578 |
| Located between position 51873135 and 51873217 on chromosome X strand - |
| Overlapping with sense strand of XM_001088879.1 (intron 60). |
| (Ensemble: ENSMMUT00000008929) |
| mature miRNAs for MI0007578: |
| mml-let-7f (MIMAT0006156): TGAGGTAGTAGATTGTATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7F-2 (accession: 100315174) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |