| Basic information from miRBase |
| hairpin accession number: MI0007579 |
| Located between position 84124916 and 84124999 on chromosome 2 strand + |
| Overlapping with sense strand of XM_001089863.1 (intron 2). |
| (Ensemble: ENSMMUT00000011508) |
| mature miRNAs for MI0007579: |
| mml-let-7g (MIMAT0006157): TGAGGTAGTAGTTTGTACAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7G (accession: 100315390) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |