| Basic information from miRBase |
| hairpin accession number: MI0007580 |
| Located between position 59792467 and 59792551 on chromosome 11 strand + |
| mature miRNAs for MI0007580: |
| mml-let-7i (MIMAT0006158): TGAGGTAGTAGTTTGTGCTGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7I (accession: 100315443) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |