| Basic information from miRBase |
| hairpin accession number: MI0007568 |
| Located between position 1973274 and 1973350 on chromosome 10 strand - |
| mature miRNAs for MI0007568: |
| mml-miR-1 (MIMAT0006150): TGGAATGTAAAGAAGTATGTAT |
| You can find this miRNA in ENTREZGENE: MIR1-1 (accession: 100315168) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |