| Basic information from miRBase |
| hairpin accession number: MI0007569 |
| Located between position 14835315 and 14835386 on chromosome 18 strand - |
| Overlapping with antisense strand of XM_001092086.1 (intron 12). |
| (Ensemble: ENSMMUT00000014297) |
| mature miRNAs for MI0007569: |
| mml-miR-1 (MIMAT0006150): TGGAATGTAAAGAAGTATGTAT |
| You can find this miRNA in ENTREZGENE: MIR1-2 (accession: 100315169) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |