| Basic information from miRBase |
| hairpin accession number: MI0007610 |
| Located between position 72366624 and 72366702 on chromosome 15 strand - |
| Overlapping with sense strand of (intron 6). |
| (Ensemble: ENSMMUT00000046152) |
| mature miRNAs for MI0007610: |
| mml-miR-101 (MIMAT0002431): TACAGTACTGTGATAACTGAAG |
| You can find this miRNA in ENTREZGENE: MIR101-2 (accession: 100315190) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |