Basic information from miRBase |
hairpin accession number: MI0002750 |
Located between position 150473546 and 150473626 on chromosome X strand - |
Overlapping with sense strand of XM_001099995.1 (intron 1). |
(Ensemble: ENSMMUT00000002176) |
mature miRNAs for MI0002750: |
mml-miR-105 (MIMAT0002454): TCAAATGCTCAGACTCCTGTGGT |
You can find this miRNA in EMBL: AY866101 (accession: AY866101) |
References |
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |