miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002750
Located between position 150473546 and 150473626 on chromosome X strand -
Overlapping with sense strand of XM_001099995.1 (intron 1).
(Ensemble: ENSMMUT00000002176)
mature miRNAs for MI0002750:
         mml-miR-105 (MIMAT0002454): TCAAATGCTCAGACTCCTGTGGT
You can find this miRNA in EMBL: AY866101 (accession: AY866101)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"