| Basic information from miRBase |
| hairpin accession number: MI0007588 |
| Located between position 39792044 and 39792153 on chromosome 12 strand + |
| mature miRNAs for MI0007588: |
| mml-miR-10b (MIMAT0006162): TACCCTGTAGAACCGAATTTGTG |
| You can find this miRNA in ENTREZGENE: MIR10B (accession: 100315178) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |