| Basic information from miRBase |
| hairpin accession number: MI0006325 |
| Located between position 146557006 and 146557079 on chromosome 8 strand - |
| Overlapping with sense strand of XM_001082048.1 (intron 27). |
| (Ensemble: ENSMMUT00000000565) |
| mature miRNAs for MI0006325: |
| mml-miR-1235 (MIMAT0005590): TCTAACCGCACCGTCCCCCAG |
| You can find this miRNA in ENTREZGENE: MIR1235 (accession: 100315160) |
| References |
| [1]Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC, Mol Cell. 28:328-336(2007)., "Mammalian mirtron genes" |