| Basic information from miRBase |
| hairpin accession number: MI0006329 |
| Located between position 17710838 and 17710942 on chromosome 19 strand + |
| Overlapping with sense strand of XM_001115216.1 (intron 14). |
| (Ensemble: ENSMMUT00000004479) |
| mature miRNAs for MI0006329: |
| mml-miR-1239 (MIMAT0005594): TTCCCCATTCTGCCTGGCCTAG |
| You can find this miRNA in ENTREZGENE: MIR1239 (accession: 100315498) |
| References |
| [1]Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC, Mol Cell. 28:328-336(2007)., "Mammalian mirtron genes" |