Basic information from miRBase |
hairpin accession number: MI0006330 |
Located between position 83077563 and 83077645 on chromosome 12 strand - |
Overlapping with sense strand of XP_001098187.1 (intron 7). |
(Ensemble: ENSMMUT00000044562) |
mature miRNAs for MI0006330: |
mml-miR-1240 (MIMAT0005861): TCACCATGACCCTGATCCCACT |
You can find this miRNA in ENTREZGENE: MIR1240 (accession: 100315161) |
References |
[1]Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC, Mol Cell. 28:328-336(2007)., "Mammalian mirtron genes" |