| Basic information from miRBase |
| hairpin accession number: MI0002582 |
| Located between position 164166923 and 164167019 on chromosome 7 strand + |
| Overlapping with antisense strand of XM_001110319.1 (exon 1). |
| (Ensemble: ENSMMUT00000007702) |
| mature miRNAs for MI0002582: |
| mml-miR-127 (MIMAT0002281): TCGGATCCGTCTGAGCTTGGCT |
| You can find this miRNA in EMBL: AY865920 (accession: AY865920) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |