| Basic information from miRBase |
| hairpin accession number: MI0007643 |
| Located between position 32253411 and 32253497 on chromosome 16 strand - |
| Overlapping with sense strand of XM_001084942.1 (intron 1). |
| (Ensemble: ENSMMUT00000030861) |
| mature miRNAs for MI0007643: |
| mml-miR-152 (MIMAT0006214): TCAGTGCATGACAGAACTTGG |
| You can find this miRNA in ENTREZGENE: MIR152 (accession: 100315515) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |