| Basic information from miRBase |
| hairpin accession number: MI0002563 |
| Located between position 83148687 and 83148776 on chromosome 12 strand - |
| Overlapping with sense strand of XM_001115371.1 (intron 10). |
| (Ensemble: ENSMMUT00000044551) |
| mature miRNAs for MI0002563: |
| mml-miR-153 (MIMAT0002271): TTGCATAGTCACAAAAGTGA |
| You can find this miRNA in EMBL: AY865901 (accession: AY865901) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |