| Basic information from miRBase |
| hairpin accession number: MI0002566 |
| Located between position 194696747 and 194696833 on chromosome 3 strand - |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSMMUT00000041458) |
| mature miRNAs for MI0002566: |
| mml-miR-153 (MIMAT0002271): TTGCATAGTCACAAAAGTGA |
| You can find this miRNA in EMBL: AY865904 (accession: AY865904) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |