| Basic information from miRBase |
| hairpin accession number: MI0007644 |
| Located between position 164343663 and 164343746 on chromosome 7 strand + |
| mature miRNAs for MI0007644: |
| mml-miR-154 (MIMAT0006215): TAGGTTATCCGTGTTGCCTTCG |
| You can find this miRNA in ENTREZGENE: MIR154 (accession: 100315208) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |