| Basic information from miRBase |
| hairpin accession number: MI0007645 |
| Located between position 21097273 and 21097337 on chromosome 3 strand - |
| mature miRNAs for MI0007645: |
| mml-miR-155 (MIMAT0006216): TTAATGCTAATCGTGATAGGGGT |
| You can find this miRNA in ENTREZGENE: MIR155 (accession: 100315397) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |