miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002957
Located between position 28867813 and 28867895 on chromosome 17 strand -
Overlapping with sense strand of (intron 3).
(Ensemble: ENSMMUT00000043260)
mature miRNAs for MI0002957:
         mml-miR-15a (MIMAT0002650): TAGCAGCACATAATGGTTTGTG
You can find this miRNA in EMBL: AY866305 (accession: AY866305)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"