Basic information from miRBase |
hairpin accession number: MI0002957 |
Located between position 28867813 and 28867895 on chromosome 17 strand - |
Overlapping with sense strand of (intron 3). |
(Ensemble: ENSMMUT00000043260) |
mature miRNAs for MI0002957: |
mml-miR-15a (MIMAT0002650): TAGCAGCACATAATGGTTTGTG |
You can find this miRNA in EMBL: AY866305 (accession: AY866305) |
References |
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |