Basic information from miRBase |
hairpin accession number: MI0002496 |
Located between position 127281204 and 127281301 on chromosome 2 strand - |
Overlapping with sense strand of XM_001098604.1 (intron 5). |
(Ensemble: ENSMMUT00000024305) |
mature miRNAs for MI0002496: |
mml-miR-15b (MIMAT0002207): TAGCAGCACATCATGGTTTACA |
You can find this miRNA in EMBL: AY865834 (accession: AY865834) |
References |
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |