miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002496
Located between position 127281204 and 127281301 on chromosome 2 strand -
Overlapping with sense strand of XM_001098604.1 (intron 5).
(Ensemble: ENSMMUT00000024305)
mature miRNAs for MI0002496:
         mml-miR-15b (MIMAT0002207): TAGCAGCACATCATGGTTTACA
You can find this miRNA in EMBL: AY865834 (accession: AY865834)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"