| Basic information from miRBase |
| hairpin accession number: MI0002958 |
| Located between position 28867667 and 28867755 on chromosome 17 strand - |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSMMUT00000043260) |
| mature miRNAs for MI0002958: |
| mml-miR-16 (MIMAT0002651): TAGCAGCACGTAAATATTGGCG |
| You can find this miRNA in EMBL: AY866305 (accession: AY866305) |
| References |
| [1]Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR, Genome Biol. 5:R68(2004)., "Microarray analysis of microRNA expression in the developing mammalian brain" |
| [2]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |