| Basic information from miRBase |
| hairpin accession number: MI0007589 |
| Located between position 127281064 and 127281144 on chromosome 2 strand - |
| Overlapping with sense strand of XM_001098604.1 (intron 5). |
| (Ensemble: ENSMMUT00000024305) |
| mature miRNAs for MI0007589: |
| mml-miR-16 (MIMAT0002651): TAGCAGCACGTAAATATTGGCG |
| You can find this miRNA in ENTREZGENE: MIR16-2 (accession: 100315505) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |